Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAAAAGGGAGGCAAAAATGGAAAAAATAGAAGAAACAGAAAGAAGAAAAATCCATGTAATGCAGAATTTCAAAATTTCTGCATTCACGGAGAATGCAAATATATAGAGCACCTGGAAGCAGTAACATGCAAATGTCAGCAAGAATATTTCGGTGAACGGTGTGGGGAAAAGTCCATGAAAACTCACAGCATGATTGACAGTAGTTTATCAAAAATTGCATTAGCAGCCATAGCTGCCTTTATGTCTGCTGTGATCCTCACAGCTGTTGCTGTTATTACAGTCCAGCTTAGAAGACAATACGTCAGGAAATATGAAGGAGAAGCTGAGGAACGAAAGAAACTTCGACAAGAGAATGGAAATGTACATGCTATAGCATAACTGAAGATAAAATTACAGGATATCACATTGGAGTCACTGCCAAGTCATAGCCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jian Wang et al.
Cellular signalling, 53, 122-131 (2018-10-07)
Ambient particulate matter (PM) promotes the development and exacerbation of chronic respiratory diseases, including chronic obstructive pulmonary disease (COPD) and asthma, by increasing inflammation and mucus hypersecretion. However, the biological mechanisms underlying PM-induced airway inflammation and mucus hypersecretion remain unclear.
Simona Taverna et al.
Scientific reports, 7(1), 3170-3170 (2017-06-11)
Non-small cell lung cancer (NSCLC) remains the leading cause of cancer-related deaths worldwide. The majority of patients are diagnosed in advanced disease stage. Bone metastasis is the most frequent complication in NSCLC resulting in osteolytic lesions. The perfect balance between
Shuntaro Tokunaga et al.
Anticancer research, 37(5), 2225-2231 (2017-05-10)
Amrubicin (AMR) has shown promising activity for lung cancer. However, little is known about the mechanism underlying resistance to this agent. The aim of this study was to elucidate the mechanism underlying resistance to AMR. We first developed amrubicinol (AMR-OH)-resistant
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU147931-50UG | 04061828427765 |
| EHU147931-20UG | 04061828653003 |