Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAAAATGCTCAAGAGAATGAAAATGAAAGCCAAGTTTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hirotake Ichise et al.
PloS one, 11(3), e0150521-e0150521 (2016-03-08)
Phospholipase Cγ2 (PLCγ2)-deficient mice exhibit misconnections of blood and lymphatic vessels, and male infertility. However, the cell type responsible for vascular partitioning and the mechanism for male infertility remain unknown. Accordingly, we generated a mouse line that conditionally expresses endogenous
Thomas Koed Doktor et al.
Nucleic acids research, 45(1), 395-416 (2016-08-26)
Spinal Muscular Atrophy (SMA) is a neuromuscular disorder caused by insufficient levels of the Survival of Motor Neuron (SMN) protein. SMN is expressed ubiquitously and functions in RNA processing pathways that include trafficking of mRNA and assembly of snRNP complexes.
Isioma I Enwerem et al.
PloS one, 10(4), e0122348-e0122348 (2015-04-16)
Small nuclear ribonucleoproteins (snRNPs), which are required for pre-mRNA splicing, contain extensively modified snRNA. Small Cajal body-specific ribonucleoproteins (scaRNPs) mediate these modifications. It is unknown how the box C/D class of scaRNPs localizes to Cajal Bodies (CBs). The processing of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU148811-50UG | 04061828428410 |
| EHU148811-20UG | 04061831366150 |