Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGAGGCAAGGTTATATGCACTTTCTCATGATTTACAGAGAAGTGAATAACTGCAAAGTGAAGTTGCTTCTTCTACTTCAGTCTTCTCTCACTTTGATTTGCTAGTTGTTATCAATTAATGACAATTACAAACCTACTGTATCTCTAATACAGTGTGACTGGTCAGGTATTTCAGTTCTTAGGAAGGAAGTGCCAAGTTTGTTTTTGGGTTCCTGGAACAGCGCTCACCTTTGTTTAGAACACTGGTTTAAAGGGATAATCATCTCTGTCACATTAGACTATCCATCATGACCAGCAAATACTCATTTTAGGAAAAAAAAAAGCATGATCTGAAAAATACTTTTGGTGGTATGTTGGTTACCCTCCTAGCTTTCCATTTGGTTTAGAACATAAAGCAAATAGACACAGTCATACTGTCACTGCTCTGGACTGTGTGGAGCTCGCTAAAGTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xinran Li et al.
Nature communications, 10(1), 716-716 (2019-02-14)
Copy number loss of PIK3R1 (p85α) most commonly occurs in ovarian cancer among all cancer types. Here we report that ovarian cancer cells manifest a spectrum of tumorigenic phenotypes upon knockdown of PIK3R1. PIK3R1 loss activates AKT and p110-independent JAK2/STAT3
Reem Ali et al.
Cells, 8(10) (2019-10-23)
Ataxia-telegiectasia mutated (ATM), phosphatase and tensin homolog (PTEN), and p85α are key tumour suppressors. Whether ATM regulates PTEN expression and influence platinum sensitivity is unknown. We generated ATM knockdowns (KD) and CRISPR knock outs (KO) in glioblastoma (LN18, LN229) and
Jun Xu et al.
Molecular medicine reports, 12(3), 4708-4712 (2015-06-24)
The expression of osteopontin (OPN) and vascular endothelial growth factor (VEGF) are associated with the severity of cartilage destruction in osteoarthritis. However, the biological connection between OPN and VEGF in osteoarthritis remains to be elucidated. The present study was performed
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU151811-20UG | 04061831366556 |
| EHU151811-50UG | 04061828408283 |