Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAATGAGTTCAGCCACGACAGCCGCACCACCATCGGGGTTGAGTTCTCCACCCGCACTGTGATGTTGGGCACCGCTGCTGTCAAGGCTCAGATCTGGGACACAGCTGGCCTGGAGCGGTACCGAGCCATCACCTCGGCGTACTATCGTGGTGCAGTGGGGGCCCTCCTGGTGTTTGACCTAACCAAGCACCAGACCTATGCTGTGGTGGAGCGATGGCTGAAGGAGCTCTATGACCATGCTGAAGCCACGATCGTCGTCATGCTCGTGGGTAACAAAAGTGACCTCAGCCAGGCCCGGGAAGTGCCCACTGAGGAGGCCCGAATGTTCGCTGAAAACAATGGACTGCTCTTCCTGGAGACCTCAGCCCTGGACTCTACCAATGTTGAGCTAGCCTTTGAGACTGTCCTGAAAGAAATCTTTGCGAAGGTGTCCAAGCAGAGACAGAACAGCATCCGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sehime Gulsun Temel et al.
Apoptosis : an international journal on programmed cell death, 25(11-12), 799-816 (2020-09-10)
Ovarian cancer remains one of the most frequent causes of cancer-related death in women. Many patients with ovarian cancer suffer from de novo or acquired resistance to chemotherapy. Here, we report that RAB25 suppresses chemotherapy-induced mitochondrial apoptosis signaling in ovarian
Moorthy Krishnan et al.
Molecular biology of the cell, 24(6), 818-831 (2013-01-25)
Rab25 is a tumor suppressor for colon cancer in humans and mice. To identify elements of intestinal polarity regulated by Rab25, we developed Caco2-BBE cell lines stably expressing short hairpin RNA for Rab25 and lines rescuing Rab25 knockdown with reexpression
Ukhyun Jo et al.
Oncotarget, 5(5), 1265-1278 (2014-03-25)
Oncogenic alterations of epidermal growth factor receptor (EGFR) signaling are frequently observed in lung cancer patients with worse differentiation and poor prognosis. However, the therapeutic efficacy of EGFR-tyrosine kinase inhibitors (TKIs) is currently limited in selected patients with EGFR mutations.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU157721-20UG | 04061831367492 |
| EHU157721-50UG | 04061828419210 |