Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCGACAGCTCTCCAATACTCAGGTTAATGCTGAAAAATCATCCAAGACAGTTATTGCAAGAGTTTAATTTTTGAAAACTGGCTACTGCTCTGTGTTTACAGACGTGTGCAGTTGTAGGCATGTAGCTACAGGACATTTTTAAGGGCCCAGGATCGTTTTTTCCCAGGGCAAGCAGAAGAGAAAATGTTGTATATGTCTTTTACCCGGCACATTCCCCTTGCCTAAATACAAGGGCTGGAGTCTGCACGGGACCTATTAGAGTATTTTCCACAATGATGATGATTTCAGCAGGGATGACGTCATCATCACATTCAGGGCTATTTTTTCCCCCACAAACCCAAGGGCAGGGGCCACTCTTAGCTAAATCCCTCCCCGTGACTGCAATAGAACCCTCTGGGGAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hiroaki Fujimori et al.
Scientific reports, 5, 18231-18231 (2015-12-17)
A comprehensive genome-wide screen of radiosensitization targets in HeLa cells was performed using a shRNA-library/functional cluster analysis and DNMT3B was identified as a candidate target. DNMT3B RNAi increased the sensitivity of HeLa, A549 and HCT116 cells to both γ-irradiation and
Yue Zhou et al.
American journal of translational research, 11(3), 1736-1747 (2019-04-12)
Temporomandibular joint (TMJ) arthritis causes severe debilitation and has few treatment options. Here, we found a small molecule, DNA methyltransferase 3B (Dnmt3b), as a putative therapeutic target, partially rescued osteoarthritic phenotype. Dnmt3b was detected differentially expressed in cell zones of
Chelsea R McCoy et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 39(16), 3144-3158 (2019-01-27)
There is growing evidence of abnormal epigenetic processes playing a role in the neurobiology of psychiatric disorders, although the precise nature of these anomalies remains largely unknown. To study neurobiological (including epigenetic) factors that influence emotionality, we use rats bred
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU158451-20UG | 04061831367669 |
| EHU158451-50UG | 04061828410057 |