Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTCCTGCATCTTCCTTCCTGAGCCTGTGGGCAGAAGCGAGATCAATGTGGAAGGGCCACCCAGGATCAAGGTCGGAAAGAAATCAGAGCATTCCAGTGAGGGAGAGCTTGCGAAACTGGTCTGCAAGTCCGATGCATCCTACCCTCCTATTACAGATTGGTTCTGGTTTAAGACCTCTGACACTGGGGAAGAAGAGGCAATCACCAATAGCACTGAAGCCAATGGCAAGTATGTGGTGGTATCCACGCCTGAGAAGTCACAGCTGACCATCAGCAACCTTGACGTAAATGTTGACCCTGGCACCTACGTGTGTAATGCCACCAACGCCCAGGGCACTACTCGGGAAACCATCTCACTGCGTGTGCGGAGCCGCATGGCAGCCCTCTGGCCCTTCCTAGGCATCGTGGCTGAGGTCCTGGTGTTGGTT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... BSG(12215), Bsg(12215)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lipan Peng et al.
Molecular and cellular biochemistry, 405(1-2), 73-79 (2015-04-12)
Chemotherapy remains the core of anticancer treatment. However, despite the tremendous strides made in the development of targeted anticancer therapies, emergence of resistance to chemotherapeutic drugs is still a major obstacle in the successful management of resistant tumors. Therefore, profound
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)
Eleni Milia-Argeiti et al.
Biochimica et biophysica acta, 1840(8), 2581-2588 (2014-03-13)
Elevated levels of EMMPRIN/CD147 in cancer tissues have been correlated with tumor progression but the regulation of its expression is not yet understood. Here, the regulation of EMMPRIN expression was investigated in testicular germ cell tumor (TGCTs) cell lines. EMMPRIN
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU014431-20UG | 04061828483693 |
| EMU014431-50UG | 04061828258420 |