EMU014921
MISSION® esiRNA
targeting mouse Parp1
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCCATCAAGAATGAAGGAAAGAGAAAAGGTGACGAGGTGGATGGAACAGATGAAGTGGCCAAAAAGAAATCTAAGAAAGGGAAGGACAAGGATAGTAGTAAGCTGGAGAAGGCCCTCAAGGCTCAGAATGAGCTGATCTGGAATATCAAAGACGAGCTGAAGAAAGCGTGTTCCACCAACGACCTGAAGGAGCTGCTCATCTTCAACCAGCAGCAGGTGCCGTCAGGAGAGTCAGCGATCTTGGACAGAGTTGCTGACGGCATGGCGTTTGGGGCCCTTCTGCCCTGCAAGGAGTGTTCAGGCCAGCTGGTCTTTAAGAGCGACGCTTATTACTGTACTGGGGATGTCACTGCCTGGACCAAGTGCATGGTCAAGACACAGAATCCTAGCCGAAAGGAATGGGTAACTCCAAAGGAATTCCGAGAAA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... PARP1(11545), Parp1(11545)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Hui Peng et al.
PloS one, 10(5), e0125318-e0125318 (2015-05-21)
Microsomal epoxide hydrolase (mEH) is a bifunctional protein that plays a central role in the metabolism of numerous xenobiotics as well as mediating the sodium-dependent transport of bile acids into hepatocytes. These compounds are involved in cholesterol homeostasis, lipid digestion
Hyeon-Jun Shin et al.
Scientific reports, 5, 15798-15798 (2015-11-03)
Necrosis, unregulated cell death, is characterized by plasma membrane rupture as well as nuclear and cellular swelling. However, it has recently been reported that necrosis is a regulated form of cell death mediated by poly-(ADP-ribose) polymerase 1 (PARP1). PARP1 is
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU014921-20UG | 04061828462087 |
| EMU014921-50UG | 04061828236831 |