EMU017111
MISSION® esiRNA
targeting mouse Pgp
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGACCCACACTTCAGCTACATGAAGCTCACCAAGGCCGTGCGGTACCTGCAGCAGCCCGACTGTCTGCTCGTGGGCACCAACATGGACAACCGGCTCCCGCTAGAGAACGGCCGTTTCATTGCGGGTACCGGCTGTCTGGTGCGAGCCGTGGAGATGGCCGCCCAGCGCCAGGCGGACATCATCGGGAAGCCTAGCCGCTTCATCTTCGACTGCGTGTCCCAGGAGTATGGTATCAACCCGGAGCGCACCGTCATGGTGGGAGACCGCCTGGACACAGACATCCTCCTGGGCTCCACCTGTAGCCTGAAGACTATCCTGACCCTCACCGGAGTCTCCAGTCTTGAGGATGTGAAGAGCAATCAGGAAAGTGACTGCATGTTCAAGAAGAAAATGGTCCCTGACTTCTATGTTGACAGCATTGCCGACCTCTT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... PGP(67078), Pgp(67078)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hui-Hui Guo et al.
Nature communications, 10(1), 1981-1981 (2019-05-02)
Cardiovascular and metabolic disease (CMD) remains a main cause of premature death worldwide. Berberine (BBR), a lipid-lowering botanic compound with diversified potency against metabolic disorders, is a promising candidate for ameliorating CMD. The liver is the target of BBR so
Hong Yang et al.
Biomaterials science, 6(9), 2426-2439 (2018-07-25)
The efficacy of cancer chemotherapy can be generally restrained by the multiple drug resistance (MDR) of tumors, which is typically attributed to the upregulation of ATP-binding cassette (ABC) transporter proteins, such as P-glycoprotein (P-gp). There is an urgent need to
Anting Jin et al.
Bioactive materials, 5(3), 522-541 (2020-04-24)
Inspired by the mechanism of mussel adhesion, polydopamine (PDA), a versatile polymer for surface modification has been discovered. Owing to its unique properties like extraordinary adhesiveness, excellent biocompatibility, mild synthesis requirements, as well as distinctive drug loading approach, strong photothermal
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU017111-50UG | 04061828238323 |
| EMU017111-20UG | 04061828463688 |