EMU047871
MISSION® esiRNA
targeting mouse Akt2
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGGCCACGGTACTTCCTTCTGAAGAGTGATGGATCTTTCATTGGGTATAAGGAGAGGCCCGAGGCCCCTGACCAGACCTTACCCCCCCTGAACAATTTCTCTGTAGCAGAATGCCAGCTGATGAAGACTGAGAGGCCACGACCCAACACCTTTGTCATACGCTGCCTGCAGTGGACCACAGTCATCGAGAGGACCTTCCATGTAGACTCTCCAGATGAGAGGGAAGAGTGGATGCGGGCTATCCAGATGGTCGCCAACAGTCTGAAGCAGCGGGGCCCAGGTGAGGACGCCATGGATTACAAGTGTGGCTCCCCCAGTGACTCTTCCACATCTGAGATGATGGAGGTAGCTGTCAACAAGGCACGGGCCAAAGTGACCATGAATGACTTCGATTATCTCAAACTCCTCGGCAAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... AKT2(11652), Akt2(11652)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yong Cui et al.
OncoTargets and therapy, 8, 1681-1690 (2015-07-18)
The AKT2 kinase (protein kinase Bβ) is overexpressed in high-grade gliomas. Upregulation of the AKT2 gene has been previously observed in glioblastoma patients suffering from chemotherapy failure and tumor progress. In this study, we aimed to evaluate the effect of
Dineo Khabele et al.
Journal of Cancer, 5(8), 670-678 (2014-09-27)
Overexpression of the epidermal growth factor receptor (EGFR) is associated with the malignant phenotype in many cancers including ovarian cancer, which leads to increased cell proliferation and survival. In spite of emerging EGFR inhibitors as a potentially useful agent, they
Samir Attoub et al.
Scientific reports, 5, 12759-12759 (2015-08-04)
The Akt/PKB serine/threonine protein kinase consists of three isoforms: Akt-1, -2 and -3. Their overexpression has been detected in human cancers, but their roles in cancer progression are unclear. We investigated the impact of specific silencing of Akt1 and Akt2
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU047871-20UG | 04061831347562 |
| EMU047871-50UG | 04061828293346 |