EMU063881
MISSION® esiRNA
targeting mouse Pecam1
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCAGGAGTCCTTCTCCACTCCCAAGTTTGAAATCAAGCCCCCTGGGATGATCATAGAAGGGGACCAGCTGCACATTAGGTGCATAGTTCAAGTGACACACTTGGTCCAGGAGTTTACAGAAATTATCATCCAAAAAGACAAGGCGATTGTAGCCACCTCCAAGCAAAGCAGTGAAGCTGTCTACTCAGTCATGGCCATGGTCGAGTACAGTGGACACTACACCTGCAAAGTGGAATCAAACCGTATCTCCAAAGCCAGTAGCATCATGGTCAACATAACAGAGCTGTTTCCCAAGCCGAAGTTAGAGTTCTCCTCCAGTCGTCTGGACCAAGGGGAGTTGTTGGACCTGTCCTGCTCCGTCTCGGGCACACCTGTAGCCAACTTCACCATCCAGAAGGAAGAGACGG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... PECAM1(18613), Pecam1(18613)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Masayasu Hara et al.
Anticancer research, 36(1), 169-177 (2016-01-02)
We evaluated the ability of itraconazole to enhance the effects of bevacizumab in bevacizumab-resistant cancer cells, endothelial cells, and cancer-associated fibroblasts (CAFs). Human gastrointestinal cancer cell lines (HT-29, MKN-28 and MKN-45), human umbilical vein endothelial cells (HUVECs), and CAFs established
Larissa Pfisterer et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 28(8), 3518-3527 (2014-04-29)
Despite the high prevalence of venous diseases that are associated with and based on the structural reorganization of the venous vessel wall, not much is known about their mechanistic causes. In this context, we demonstrated that the quantity of myocardin
Caroline Arnold et al.
EMBO molecular medicine, 6(8), 1075-1089 (2014-06-29)
Arteriogenesis-the growth of collateral arterioles-partially compensates for the progressive occlusion of large conductance arteries as it may occur as a consequence of coronary, cerebral or peripheral artery disease. Despite being clinically highly relevant, mechanisms driving this process remain elusive. In
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU063881-50UG | 04061828265466 |
| EMU063881-20UG | 04061828490783 |