Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGGGTGCCAAGGATTGAAGAAGAAAAGTCAGAAGAGGAGACTTCAGCCCCTGCCATCACCACTGTAACAGTGCCAACCCCCATTTACCAAACTAGCAGTGGGCAGTACATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACGGATGGGGTACAGGGCCTGCAGACATTAACCATGACCAATGCAGCTGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATTCTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCAGGCGATGTACAAACATACCAGATCCGCACAGCACCCACGAGCACCATTGCCCCTGGAGTTGTTA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... CREB1(12912), Creb1(12912)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jian Ye et al.
EMBO molecular medicine, 6(10), 1294-1311 (2014-09-19)
Accumulating evidence suggests the immunosuppressive microenvironments created by malignant tumors represent a major obstacle for effective anti-tumor immunity. A better understanding of the suppressive mechanisms mediated by tumor microenvironments and the development of strategies to reverse the immune suppression are
Mutsumi Fujii et al.
Experimental neurology, 261, 396-403 (2014-07-25)
Early brain injury (EBI) which comprises of vasogenic edema and apoptotic cell death is an important component of subarachnoid hemorrhage (SAH) pathophysiology. This study evaluated whether cannabinoid receptor type 2 (CB2R) agonist, JWH133, attenuates EBI after SAH and whether CB2R
Wencheng Li et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 309(2), R138-R147 (2015-05-23)
We reported that brain (pro)renin receptor (PRR) expression levels are elevated in DOCA-salt-induced hypertension; however, the underlying mechanism remained unknown. To address whether ANG II type 1 receptor (AT1R) signaling is involved in this regulation, we implanted a DOCA pellet
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU067571-20UG | 04061831339130 |
| EMU067571-50UG | 04061828251636 |