Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGAAGATGTCAAGATGGCTTTTGATAGAGATGGTGAGAAGGCGGATATTTCTGTGAACATGTATGAGGACATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATCTGCCAATTCCTCTCATCACATACGATGCCTACCCCAAGTTCATTGAGTCTGCCAAAATTATGGACCCTGACGAGCAATTGGAGACCCTTCACGAAGCACTGAGATCGCTGCCGCCTGCCCACTGCGAGACGCTCCGGTACCTCATGGCGCATCTCAAGAGAGTGACCCTTCATGAGAAGGAGAATCTGATGAGTGCAGAGAACCTTGGGATCGTGTTTGGACCAACCCTCATGAGATCCCCAGAGCTCG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... CHN1(108699), Chn1(108699)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Junlan Feng et al.
Journal of cellular and molecular medicine, 18(10), 2125-2134 (2014-09-19)
Our previously published study documented a deregulation of the microRNA miR-150 in colorectal cancer. Here, we investigated further, in vitro and in vivo, the potential molecular mechanisms underlying the involvement of miR-150 in colorectal cancer, using the appropriate molecular biological
Han Lin et al.
Molecular and cellular biology, 35(21), 3657-3668 (2015-08-19)
Cdc14 is a phosphatase that controls mitotic exit and cytokinesis in budding yeast. In mammals, the two Cdc14 homologues, Cdc14A and Cdc14B, have been proposed to regulate DNA damage repair, whereas the mitotic exit and cytokinesis rely on another phosphatase
Deguang Xing et al.
Oncology reports, 31(6), 2692-2700 (2014-04-24)
In the present study, we designed and conducted a series of assays to determine the expression of voltage-gated sodium channel (VGSC) neonatal isoform Nav1.5 (nNav1.5) in human brain astrocytoma and its effect on the proliferation, migration, invasion and apoptosis of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU173171-20UG | 04061828758968 |
| EMU173171-50UG | 04061828707775 |