HMI1002
MISSION® microRNA Mimic
hsa-miR-122
Synonym(s):
hsa-miR-122-5p
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
product line
MISSION®
form
solid
mature sequence
UGGAGUGUGACAAUGGUGUUUG
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
human ... hsa-miR-122(406906)
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Other Notes
miRBase V18 Mature ID update: hsa-miR-122-5p
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
13 - Non Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
常规特殊物品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Virginie Vignard et al.
Cancer immunology research, 8(2), 255-267 (2019-12-21)
MicroRNAs (miRNA), small noncoding RNAs that regulate gene expression, exist not only in cells but also in a variety of body fluids. These circulating miRNAs could enable intercellular communication. miRNAs are packaged in membrane-encapsulated vesicles, such as exosomes, or protected
Global Trade Item Number
| SKU | GTIN |
|---|---|
| HMI1002-5NMOL | 04061831384666 |